Part 1: Transcribe a small fragment of DNA (3 pts) Start with a DNA sequence for the coding strand of a hypothetical gene and provide the sequence of the corresponding template strand, and resulting mRNA sequence after transcription. Coding Strand of DNA: 5′ CCCATGGGCTTCAGAGATTCGTGA 3′ On a blank piece of paper, copy the coding strand of DNA onto a piece of paper, and use different colors for each nucleotide. You can either use different colors of ink, or shade with colored pencils, crayolas or highlighters. Note: it is very helpful to line up the coding strand, template strand, and mRNA sequence close to each other as you are working on questions below. Coding Strand of DNA: 5′ CCCATGGGC’I’I’CAGAGATTCGTGA 3′ Template Strand: mRNA sequence: 1. Provide the sequence and orientation for the Template Strand. The template strand is complementary to the Coding Strand and is oriented in the opposite direction (from 3′ to 5′). Use the same color coding scheme for nucleotides as you did for the coding strand. Template Strand: 2. Based on the template sequence, provide the sequence of the mRNA molecule that would be transcribed by the cell. The mRNA sequence is complementary to the template strand, oriented in the opposite direction (from 5′ to 3′), and is composed of RNA nucleotides. Use a similar coloring scheme for nucleotides as you did for the DNA strands. mRNA Sequence: 3. Explain what is accomplished in transcription and where it takes place in prokaryotic cells and in eukaryotic cells. Show less

Part 2: Translate the mRNA molecule into a protein sequence (4 pts) Carefully copy the color-coded sequence of mRNA you transcribed in part 1.2 above. Use the universal genetic code table (Table 15.1) to determine the amino acid sequence of a protein that would be translated by the cell. 1. Draw a circle around the start codon in the mRNA molecule. (Remember what role the start codon plays in translation!) 2. Draw a rectangle around the stop codon in the mRNA molecule. 3. Provide the sequence of amino acids (3 letter code) in the translated protein, indicate the end of the protein with STOP Protein sequence: 4. Explain what is accomplished in translation and where it takes place in prokaryotic cells and in eukaryotic cells. Part 3: Explore the effect of a mutation in a gene on protein sequence (3 pts) Coding Strand of DNA: 5′ CCCATGGGCTTCAGAGATTCGTGA 3′ 1. Randomly change one base (point mutation) in the coding strand of DNA. Indicate where you introduced the mutation. Mutated coding strand of DNA (circle the mutation): 2. Explain the effect of that the single point mutation on the protein sequence that is translated. Compare this new protein to the protein sequence from Part 2.3. Show less

Part 3: Explore the effect of a mutation in a gene on protein sequence (3 pts) Coding Strand of DNA: 5′ CCCATGGGCTTCAGAGATTCGTGA 3′ 1′ Randomly change one base (point mutation) in the coding strand of DNA. Indicate where you introduced the mutation. Mutated coding strand of DNA (circle the mutation): 2′ Explain the effect of that the single point mutation on the protein sequence that is translated. Compare this new protein to the protein sequence from Part 2.3. Show less

TABLE 15.1 The Genetic Code SECOND LETTER First Third Letter U C A G Letter UUU UCU UAU Tyr Tyrosine UGU C Phe Phenylalanine Cys Cysteine UUC UCC UAC UGC C Ser Serine UUA UCA UAA "Stop" UGA "Stop" D Leu Leucine UUG UCG UAG "Stop" UGG Trp Tryptophan G CUU CCU CAU CGU C His Histidine CUC CCC CAC CGC Leu Leucine Pro Proline Arg Arginine CUA CCA CAA CGA D Gir Glutamine CUG CCG CAG CGG G AUU ACU AAU AGU C Asn Asparagine Ser Serine AUC lle Isoleucine ACC AAC AGC The Threonine AUA ACA AAA AGA D Lysine Arginine AUG Met Methionine; "Start" Lys Arg ACG AAG AGG G GUU GCU GAU GGU C Asp Aspartate GUC GCC GAC GGC Val Valine Ala Alanine Gly Glycine GUA GCA GAA GGA D Glu Glutamate GUG GCG GAG GGG G A codon consists of three nucleotides read in the sequence shown. For example, ACU codes for threonine. The first letter, A, is in the First Letter column; the second letter, C, is in the Second Letter column; and the third letter, U, is in the Third Letter column. Each of the mRNA codons is recognized by a corresponding anticodon sequence on a tRNA molecule. Many amino acids are specified by more than one codon. For example, threonine is specified by four codons, which differ only in the third nucleotide (ACU, ACC, ACA, and ACG). Show less

Recitation: Transcription/Translation (1) Criteria Ratings Pts Transcription 3 pts 1.5 pts 0 pts Full marks Partial marks No Marks Diagram includes the following: – correct sequence and orientation One of the following is missing, incorrect, or incomplete: – correct Very incomplete, for template strand – correct sequence and orientation for mRNA – sequence and orientation for template strand – correct sequence and incorrect, or 3 pts explains what is accomplished by transcription and where it happens orientation for mRNA – explains what is accomplished by transcription and missing in prokaryotic and eukaryotic cells where it happens in prokaryotic and eukaryotic cells Translation 4 pts 2 pts 0 pts Full marks Partial marks No Marks Diagram includes the following: – start codon indicated on mRNA – One of these items may be missing or incorrect. – start codon indicated Very incomplete, 4 pts stop codon indicated on mRNA – amino acid sequence of protein is on mRNA – stop codon indicated on mRNA – amino acid sequence of incorrect, or missing correct – protein ends with a STOP protein is correct – protein ends with a STOP Mutation 3 pts 1.5 pts 0 pts Full marks Partial marks No Marks Diagram includes the following – indication of mutation in a mutated One item may be missing or incorrect. – indication of mutation in a Very incomplete, 3 pts coding strand – explanation of effect of mutation on the protein mutated coding strand – explanation of effect of mutation on the incorrect, or missing (change in amino acid, frame shift, or other) protein (change in amino acid, frame shift, or other) Total Points: 10 Show less